Skip to content

Immunoproliferacyjna drobna choroba jelitowa związana z Campylobacter jejuni ad 5

4 miesiące ago

476 words

Warunki cykliczne dla wszystkich reakcji łańcuchowych polimerazy (PCR) były następujące: 7 minut w 95 ° C, 35 cykli denaturacji przez 30 sekund w 95 ° C, hybrydyzacja przez 20 sekund w 55 ° C i 2 minuty wydłużenia przy 72 ° C C, a następnie 10 minut w 72 ° C. Tabela 1. Tabela 1. Wyniki testów reakcji łańcuchowej polimerazy (PCR) próbek biopsyjnych od pacjenta z indeksem z immunoproliferacyjną chorobą jelitową i próbkami kontrolnymi. Specyficzność testów PCR ustalono początkowo przy użyciu DNA wyekstrahowanego z trzech wymienionych powyżej szczepów referencyjnych (tabela 1). W przypadku pacjenta będącego wskaźnikiem, subklonowano amplikony z genów rybosomalnych 16S, a sekwencje nukleotydowe 12 losowo wybranych klonów określono na obu niciach. Wszystkie sekwencje rDNA 16S, które były co najmniej w 99% homologiczne, uważano za należące do tego samego gatunku.17,18
Fluorescencja w hybrydyzacji in situ
Znakowane Cy3 5 ATTACTGAGATGACTAGCACCCC3 (Cj-490) użyto do sondowania na obecność C. jejuni, 19 podczas gdy do oznaczenia H. pylori użyto znakowanego Cy3 5 CACACCTGACTGACTATCCCG3 (Hpy-1). 20 Deparafinizowany, formalina skrawki o grubości 5 .m inkubowano przez 10 minut w buforze lizozymowym (10 mg lizozymu na mililitr [Sigma], 100 mM TRIS kwas solny [pH 8] i 50 mM EDTA) w temperaturze pokojowej, a następnie przez 2 minuty. godziny w 35 ° C w komorach do hybrydyzacji z sondą oligonukleotydową (rozcieńczone do końcowego stężenia 4,5 ng na mikrolitr w roztworze 30% formamidu, 0,9 M chlorku sodu, 20 mM TRIS-kwasu solnego [pH 8] i 0,01% dodecylosiarczan sodu). Skrawki tkanki przemyto dwukrotnie (przez 15 minut w 37 ° C na cykl) w buforze do przemywania (0,9 M chlorek sodu, 20 mM TRIS kwas solny [pH 8], 5 mM EDTA i 0,01 procentowy dodecylosiarczan sodu) i jeden raz w Woda destylowana, suszona w temperaturze pokojowej, montowana i obserwowana za pomocą mikroskopii epifluorescencyjnej.
Wszystkie zbadane próbki tkanek zebrano w ramach rutynowej opieki. Krajowy Komitet ds. Etyki we Francji nie wymaga ani zatwierdzenia przez komisje ds. Weryfikacji instytucjonalnej, ani świadomej zgody na przeprowadzenie tego rodzaju badań.
Wyniki
Identyfikacja DNA C. jejuni
DNA wyekstrahowano z próbek zamrożonego jelita czczego i żołądka-biopsję od pacjenta z indeksem. Początkowe testy PCR tych DNA przeprowadzono przy użyciu dobrze znanych uniwersalnych starterów znanych z generowania amplikonów z genów 16S rDNA z większości gromad w superzymaniu bakterii.14 Amplikony wytwarzano w testach, w których matrycę DNA ekstrahowano z zamrożonego jelita czczego próbki zebrane jeden dzień przed rozpoczęciem leczenia. Przeciwnie, nie wyprodukowano amplikonów przy użyciu DNA przygotowanego z materiału zebranego osiem dni po rozpoczęciu terapii.
Sekwencje nukleotydów 8 z 12 sklonowanych amplikonów wytworzonych z preparatu do wstrzykiwania jelita czczego były w 99,6% identyczne z 16S rDNA amplifikowanym z DNA szczepu referencyjnego C. jejuni. Poszukiwania komputerów w GenBank za pomocą programu BLAST (http://www.ncbi.nlm.nih.gov/blast/) i bazy danych 16S rDNA (http://greengenes.llnl.gov/16S/) wykazały że cztery pozostałe sekwencje pochodziły z abiotrofii, neisserii, laktozy i hemofilii
[patrz też: busulfan, polyporus, celiprolol ]
[hasła pokrewne: camelis duo, ibufen forte ulotka, serowate upławy ]

0 thoughts on “Immunoproliferacyjna drobna choroba jelitowa związana z Campylobacter jejuni ad 5”