Skip to content

Immunoproliferacyjna drobna choroba jelitowa związana z Campylobacter jejuni czesc 4

2 miesiące ago

424 words

Rok po ustaleniu rozpoznania wyniki badań klinicznych i badań laboratoryjnych były prawidłowe. Sześć dodatkowych pacjentów
Immunoproliferacyjna choroba jelita cienkiego występuje rzadko. Zamrożone próbki jelitowe od innych pacjentów z nieleczoną immunoproliferacyjną chorobą jelitową nie były dla nas dostępne. W związku z tym pobraliśmy archiwalne, zatopione w parafinie wycinane wycinki jelita cienkiego pobrane w czasie laparoskopii 8 do 27 lat wcześniej od sześciu dodatkowych pacjentów, u których w jednym szpitalu rozpoznano immunoproliferacyjną chorobę jelita cienkiego zgodnie z ustalonymi kryteriami histopatologicznymi i immunologicznymi.1 5,6,12
Metody
Próbki tkanek
Przeanalizowaliśmy próbki tkanek z sześciu źródeł. Zamrożone i utrwalone w formalinie, zatopione w parafinie próbki uzyskano z biopsji żołądka, dwunastnicy i jelita czczego wykonanych endoskopowo w indeksie pacjenta na dzień przed i 8 dni po rozpoczęciu leczenia przeciwbakteryjnego. Archiwalne wycinki z jelita cienkiego, które utrwalono w płynie Bouina i zatopiono w parafinie, uzyskano od sześciu dodatkowych pacjentów, którzy otrzymali diagnozę immunoproliferacyjnej choroby jelita cienkiego. Utrwalone formaliną, zatopione w parafinie próbki z jelita czczego uzyskano endoskopowo od pacjenta zakażonego ludzkim wirusem niedoboru odporności (HIV), który miał ostre zapalenie jelit C. jejuni. Próbki żołądka utrwalone w formalinie, zatopione w parafinie uzyskano od pacjenta z zapaleniem żołądka H. pylori. Zrobione próbki bioptatu z dwunastnicy uzyskano od 10 pacjentów z przewlekłą biegunką o nieznanym pochodzeniu (zgodnie z definicją negatywną dla znanych enteropatogenów). U 10 pacjentów, u których oceniano niedokrwistość, uzyskano utrwalone formaliną, zatopione w parafinie próbki dwunastnicy.
Szczepy bakteryjne i przeciwciała
Uzyskaliśmy szczep referencyjny C. jejuni CIP 70.2, szczep referencyjny H. pylori CIP 103995 i szczep referencyjny Escherichia coli CIP 7624 z kolekcji Institut Pasteur. Do badań immunohistochemicznych użyto dwóch mysich przeciwciał monoklonalnych: IgG2b NCL-C-JEJUNI (Novocastra), który rozpoznaje wiciową determinację immunologiczną wspólną dla C. jejuni i H. pylori, 13 i IgM CP1 / IIG10 (Biotrend), która jest skierowana przeciwko antygen H. pylori o powierzchni 43 kD, niezwiązany z powierzchnią, który nie jest wykrywalny u innych gatunków helicobacter lub niepowiązanych bakterii.
Reakcja łańcuchowa polimerazy
Uniwersalne startery PB (5 TAACACATGCAAGTCGAG3 ) i DG74 (5 AGGAGGTGATCCAACCGCA3 ) zastosowano do amplifikacji bakteryjnego 16S rybosomalnego DNA (rDNA) .14 Ustanowione startery skierowane przeciwko C. jejuni (CCCJ609F 5 AATCTAATGGCTTAACCATTA3 i CCJ1442R 5 GTAACTAGTTTAGTATTCCGG3 ) 15 użyto do wytworzenia amplikonu 16S rDNA o długości 852 bp. Startery specyficzne dla H. pylori (5 fla 5 CCACGGTTAAAGCGTCTATTGG3 i 3 fla 5 GATCGCATTAGTCAACCTCCCG3 ) 16 zastosowano do amplifikacji fragmentu 401-bp z genu flaB. Dwie pary starterów – 72 / 96F (5 ACAGGAAGAAGCTTGCTTCTTTGC3 ) i 455 / 477R (5 GAGCAAAGGTATTAACTTTACTCCC3 ) i 455 / 477F (5 GGGAGTAAAGTTAATACCTTTGCTC3 ) i 1000 / 1025R (5 GATTCTCATCTCTGAAAACTTCCG3 ) zostały zaprojektowane do wzmocnienia 16S rDNA z Enterobacteriaceae
[podobne: Leukocyturia, bupropion, diklofenak ]
[przypisy: lowastatyna, zimne aglutyniny, medinet wrocław ]

0 thoughts on “Immunoproliferacyjna drobna choroba jelitowa związana z Campylobacter jejuni czesc 4”